Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CDK7

Gene ID (NCBI) 1022
Gene Symbol CDK7
Protein Name cyclin-dependent kinase 7
Synonyms CAK1|CDKN7|HCAK|MO15|STK1|p39MO15
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA damage
Featured content DNA repair (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03503 pAxCALNLhCDK7 (forward) Shuttle vector to generate rAd harboring human CDK7 (forward)
RDB03539 pAxCALNLhCDK7 (forward) Shuttle vector to generate rAd harboring human CDK7 (forward)
RDB04087 pAxCALNLhCDK7 (reverse) Shuttle vector to generate rAd harboring human CDK7 (reverse)
RDB04113 pAxCALNLhCDK7 Shuttle vector to generate rAd harboring human CDK7
RDB04996 pAxCALNLhCDK7(forward) Shuttle vector to generate rAd expressing human CDK7
RDB04997 pAxCALNLhCDK7(reverse) Shuttle vector to generate rAd expressing human CDK7

RDB_hum_161122.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001927 IRAK004N15 pCMV-SPORT6 BC000834 NM_001799 Full
HGY086626 IRAL016J10 pDNR-LIB BC005298 NM_001799 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038907 W01A097E11 pENTR-TOPO IRAK004N15 BC000834 NM_001799  
HGE038909 W01A097E13 pENTR-TOPO IRAK004N15 BC000834 NM_001799  
HGE038911 W01A097E15 pENTR-TOPO IRAK004N15 BC000834 NM_001799  
HGE048337 W01A120O01 pENTR-TOPO IRAK004N15 BC000834 NM_001799  
HGE048341 W01A120O05 pENTR-TOPO IRAK004N15 BC000834 NM_001799  
HGE048345 W01A120O09 pENTR-TOPO IRAK004N15 BC000834 NM_001799  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR248871 ARiS122C23 pGCAP10 NM_001799.3  
GGGGTGTTGGAGGCTTTAAGGTAGCTTTAAATTCGTGTTGTCCTGGGAGCTCGCCCTTTT
HKR276489 ARiS191D17 pGCAP10 NM_001799.3  
GGGACGGAAGTGGGTGTTGGAGGCTTTAAGGTAGCTTTAAATTCGTGTTGTCCTGGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl