Prev. |  KEGG KO K02091 > 

RIKEN DNA Bank Human Resource - CDK6

Gene ID NCBI Gene 1021 |  KEGG hsa:1021
Gene Symbol CDK6
Protein Name cyclin dependent kinase 6
Synonyms MCPH12|PLSTIRE
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  CDK6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011447 IRAK028K07 pCMV-SPORT6 BC012914 NM_001259 Partial/var
HGX024861 IRAK062C13 pCMV-SPORT6 BC027989 NM_001259 Partial/var
HGY099087 IRAL047L23 pOTB7 BC052264 NM_001259 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE093608 M01C034A08 pDONR221 MGC06-F04 BC027989 NM_001259  
HGE093656 M01C034C08 pDONR221 MGC06-F04 BC027989 NM_001259  
HGE093704 M01C034E08 pDONR221 MGC06-F04 BC027989 NM_001259  
HGE093752 M01C034G08 pDONR221 MGC06-F04 BC027989 NM_001259  
HGE093800 M01C034I08 pDONR221 MGC06-F04 BC027989 NM_001259  
HGE093848 M01C034K08 pDONR221 MGC06-F04 BC027989 NM_001259  
HGE093896 M01C034M08 pDONR221 MGC06-F04 BC027989 NM_001259  
HGE093944 M01C034O08 pDONR221 MGC06-F04 BC027989 NM_001259  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR191255 ARi78C07 pGCAP10 NM_001259.6  
GGTCTGATTACCTGCTCCGCGAGGCCGCGGACACGTGCGGAGAGCCGACTGACACTCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl