Prev. |  KEGG KO K02090 > 

RIKEN DNA Bank Human Resource - CDK5

Gene ID NCBI Gene 1020 |  KEGG hsa:1020
Gene Symbol CDK5
Protein Name cyclin dependent kinase 5
Synonyms LIS7|PSSALRE
Ortholog resources KEGG ortholog (KEGG orthology K02090) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Axon guidance - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05935 pAxCALNLhCDK5 (forward) Shuttle vector to generate rAd harboring human CDK5 (forward)
RDB05936 pAxCALNLhCDK5 (reverse) Shuttle vector to generate rAd harboring human CDK5 (reverse)

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083379 IRAL008H11 pOTB7 BC005115 NM_004935 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056969 ARe42H01 pKA1U5 NM_004935.2  
GCTTAAAACCGAGGGCCCGCAGGGGTCCCCGCGGCCGCCGCGATGCAGAAATACGAGAAA
HKR340921 RBb52F01 pGCAP1 NM_004935.2  
AATGTGGCCAGAGCTCTTAAAACCGAGGGCCCGCAGGGGTCCCCGCGGCCGCCGCGATGC
HKR399673 RBd99D01 pGCAP10 NM_004935.2  
GGGCTCAGGTGCCGCCTCCTCTGCAACGCCGGGGCCAGAGTCTTAAAACCGAGGGCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl