DNA Bank Top |  KEGG KO K02089 > 

RIKEN DNA Bank Human Resource - CDK4

Gene ID NCBI Gene 1019 |  KEGG hsa:1019
Gene Symbol CDK4
Protein Name cyclin dependent kinase 4
Synonyms CMM3|PSK-J3
Featured content Rb pathway
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content T cell receptor signaling pathway (human)
Featured content Influenza A relevant genes - human

Link

Ortholog resource in our bank

  CDK4


External database

human CDK4

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07907 pGL4-phCDK4 Promoter collection, Human CDK4 promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084177 IRAL010H09 pOTB7 BC005864 NM_000075 Full
HGY090885 IRAL027D13 pOTB7 BC010153 NM_000075 Full
HGY084489 IRAL011D17 pOTB7 BC003644 NM_000075 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001255 W01A003C07 pENTR-TOPO IRAL011D17 BC003644 NM_000075.4 full done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234209 ARiS085I17 pGCAP10 NM_000075.2  
TGCTCTGCGTCCAGCTGCTCCGGACCGAGCTCGGGTGTATGGGGCCGTAGGAACCGGCTC
HKR365778 RBd14H10 pGCAP10 NM_000075.2  
HKR385255 RBd63C07 pGCAP10 NM_000075.2  
GGTCTATGGTCGGGCCCTCTGCGTCCAGCTGCTCCGGACCGAGCTCGGGTGTATGGGGCC
HKR387231 RBd68B07 pGCAP10 NM_000075.2  
GCCCTCTGCGTCCAGCTGCTCCGGACCGAGCTCGGGTGTATGGGGCCGTAGGAACCGGCT
HKR475045 RBdS187K05 pGCAP10 NM_000075.2  
GTGTGTCTATGGTCGGGCCCTCTGCGTCCAGCTGCTCCGGACCGAGCTCGGGTGTATGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl