Prev. |  KEGG KO K06811 > 

RIKEN DNA Bank Human Resource - CDH17

Gene ID NCBI Gene 1015 |  KEGG hsa:1015
Gene Symbol CDH17
Protein Name cadherin 17
Synonyms CDH16|HPT-1|HPT1
Ortholog resource in our bank

  CDH17

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247467 ARiS118L03 pGCAP10 NM_004063.2 VA done
GAGTATGATATTTTGGCTGTGGATCTGAGTTGATCAATCTGCTTAGTGGACTTGAGTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl