Prev. |  KEGG KO K04393 > 

RIKEN DNA Bank Human Resource - CDC42

Gene ID NCBI Gene 998 |  KEGG hsa:998
Gene Symbol CDC42
Protein Name cell division cycle 42
Synonyms CDC42Hs|G25K|TKS
Featured content Endocytosis (human)
Featured content T cell receptor signaling pathway (human)
Featured content Axon guidance - human
Ortholog resource in our bank

  CDC42

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001981 IRAK004P21 pCMV-SPORT6 BC003682 NM_001791 Full
HGX007901 IRAK019M13 pCMV-SPORT6 BC018266 NM_001791 Full
HGY084850 IRAL012C02 pOTB7 BC002711 NM_001791 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169209 ARi23A09 pGCAP10 NM_001791.3  
GGCAGTGCTGCCAACGCCCCGGTGGAGAAGCTGAGGTCATCATCNGATTTGAAATATTTA
HKR203271 ARiS008C23 pGCAP10 NM_001791.3  
CGGCCGGCCNNNNNCCNNNGGTGCCGCNGCCGNGGNNCTCCNTTNNNNGNNGGTTAATTG
HKR369677 RBd24D05 pGCAP10 NM_001791.3  
GGCCAACGCCCCGGTGGAGAAGCTGAGGTCATCATCAGATTTGAAATATTTAAAGTGGAT
HKR444345 RBdS110O09 pGCAP10 NM_001791.3  
GAGTGCTGCCAACGCCCCGGTGGAGAAGCTGAGGTCATCATCAGATTTGAAATATTTAAA
HKR475037 RBdS187J21 pGCAP10 NM_001791.3  
AGTGCTGCCAACGCCCCGGTGGAGAAGCTGAGGTCATCATCAGATTTGAAATATTTAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl