Prev. |  KEGG KO K02207 > 

RIKEN DNA Bank Human Resource - CDC34

Gene ID NCBI Gene 997 |  KEGG hsa:997
Gene Symbol CDC34
Protein Name cell division cycle 34
Synonyms E2-CDC34|UBC3|UBCH3|UBE2R1
Ortholog resource in our bank

  CDC34

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008843 IRAK022B19 pCMV-SPORT6 BC018143 NM_004359 Full
HGY090149 IRAL025G05 pOTB7 BC009850 NM_004359 Full
HGY092908 IRAL032E12 pDNR-LIB BC023979 NM_004359 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004898 W01A012E02 pENTR-TOPO IRAL025G05 BC009850 NM_004359  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080529 ARf01F09 pKA1U5 NM_004359.1  
GAGAGCTGCTGGAGCGCTCGGGGTCCCCGGGCGGCGGCGGCGGCGCAGAGGAGGAGGCAG
HKR361257 RBd03C09 pGCAP10 NM_004359.1  
GAAGGCAAGCGCCGGTGGGGCGGCGGCGCCAGAGCTGCTGGAGCGCTCGGGGTCCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl