DNA Bank Top |  KEGG KO K05866 > 

RIKEN DNA Bank Human Resource - CDC25B

Gene ID NCBI Gene 994 |  KEGG hsa:994
Gene Symbol CDC25B
Protein Name cell division cycle 25B
Synonyms -
Featured content Rb pathway

Link

Ortholog resource in our bank

  CDC25B

External database

human CDC25B

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB02668 pAxCALNLhCDC25B (reverse) Shuttle vector to produce rAd expressing human CDC25B    
RDB02667 pAxCALNLhCDC25B (forward) Shuttle vector to produce rAd expressing human CDC25B    
RDB02334 pAxCAhCDC25B (reverse) Shuttle vector to produce rAd expressing human CDC25B    
RDB02333 pAxCAhCDC25B (forward) Shuttle vector to produce rAd expressing human CDC25B    
RDB01203 CDC25Hu2 Human cdc 25B cDNA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030953 IRAK077G09 pBluescriptR BC051711 NM_021873 Full
HGY087035 IRAL017J19 pOTB7 BC006395 NM_021873 Full
HGY088182 IRAL020H14 pOTB7 BC009953 NM_021873 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE028005 W01A070A05 pENTR-TOPO IRAK077G09 BC051711 NM_021873  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405305 RBdS013E09 pGCAP10 NM_004358.3  
GACCCCTCGCCCGCTGCCTCCCTCGGCCCAGCCAGCTGTGCCGGCGTTTGTTGGCTGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl