Prev. |  KEGG KO K16944 > 

RIKEN DNA Bank Human Resource - SEPTIN7

Gene ID NCBI Gene 989 |  KEGG hsa:989
Gene Symbol SEPTIN7
Protein Name septin 7
Synonyms CDC10|CDC3|NBLA02942|SEPT7|SEPT7A
Ortholog resource in our bank

  SEPTIN7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013364 IRAK033G20 pBluescriptR BC025987 NM_001011553 Full
HGX056625 IRAK141J09 pCMV-SPORT6 BC067264 NM_001011553 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015017 W01A037J01 pENTR-TOPO IRAK033G20 BC025987 NM_001011553  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051775 ARe29H07 pKA1U5 NM_001788.4  
TGGGAGTGCGAGATCCGCTGCTGCTGAGGAGAGGAGCGTCAACAGCAGCACCATGGCTCA
HKR070825 ARe77B01 pKA1U5 NM_001788.4  
GGCTGGTCGCGGAGGGGGGGAGGGGATGTCGNCCATTGCGAGATCCGCTGCTGCTGAGGA
HKR367754 RBd19G10 pGCAP10 NM_001788.4  
TGAGTGCGAGATCCGCTGCTGCTGAGGAGAGGAGCGTCAACAGCAGCACCATGGTAGCTC
HKR368409 RBd21A09 pGCAP10 NM_001788.4  
GGCGAGATCCGCTGCTGCTGAGGAGAGGAGCGTCAACAGCAGCACCATGGTTCCTCTGTG
HKR396075 RBd90D03 pGCAP10 NM_001788.4  
GGTGCGAGATCCGCTGCTGCTGAGGAGAGGAGCGTCAACAGCAGCACCATGGTAGCTCAA
HKR409038 RBdS022J22 pGCAP10 NM_001788.4  
TGAGTGCGAGATCCGCTGCTGCTGAGGAGAGGAGCGTCAACAGCAGCACCATGGTAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl