Prev. |  KEGG KO K12860 > 

RIKEN DNA Bank Human Resource - CDC5L

Gene ID NCBI Gene 988 |  KEGG hsa:988
Gene Symbol CDC5L
Protein Name cell division cycle 5 like
Synonyms CDC5|CDC5-LIKE|CEF1|PCDC5RP|dJ319D22.1
Ortholog resource in our bank

  CDC5L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001895 IRAK004M07 pCMV-SPORT6 BC001568 NM_001253 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR248879 ARiS122D07 pGCAP10 NM_001253.2  
GAAAGCAGAAGGTCGCGCTTGGAGGAAGTGGCGGCTTTGAGTCCGGTGGCCCAATCGCTG
HKR381753 RBd54G09 pGCAP10 NM_001253.2  
AGAAGGTCGCGCTTGGAGGAAGTGGCGGCTTTGAGTCCGGTGNNCNAATCGCTGTTACTA
HKR388805 RBd72A05 pGCAP10 NM_001253.2  
GAAAAGCAGAAGGTCGCGCTTGGAGGAAGTGGCGGCTTTGAGTCCGGTGGCCCAATCGCT
HKR392903 RBd82E07 pGCAP10 NM_001253.2  
GAAAGCAGAAGGTCGCGCTTGGAGGAAGTGGCGGCTTTGAGTCCGGTGGCCCAATCGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl