Prev. |  KEGG KO K02087 > 

RIKEN DNA Bank Human Resource - CDK1

Gene ID NCBI Gene 983 |  KEGG hsa:983
Gene Symbol CDK1
Protein Name cyclin dependent kinase 1
Synonyms CDC2|CDC28A|P34CDC2
Featured content Rb pathway
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  CDK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07816 pGL4-phCDC2 Promoter collection, Human CDK1 promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081509 IRAL003M21 pOTB7 BC014563 NM_001786 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE049705 W01A124E09 pENTR-TOPO IRAL003M21 BC014563 NM_001786  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176976 ARi42H08 pGCAP10 NM_001786.3  
CGGCCGGCCGATGGCACTTGGCTTCAAAGCTGGCTCTTGGAAATTGAGCGGAGAGCGACG
HKR243791 ARiS109H23 pGCAP10 NM_001786.3  
GGGCTTCAAAGCTGGCTCTTGGAAATTGAGCGGAGAGCGACGCGGTTGTTGTAGCTGCCG
HKR320481 RBb01D09 pKA1U5 NM_001786.3  
HKR342809 RBb57A09 pGCAP1 NM_001786.3  
GGCACTTGGCTTCAAGCTGGCTCTTGGAAATTGAGCGGAGAGCGACGCGGTTGTTGTAGC
HKR374484 RBd36D12 pGCAP10 NM_001786.3  
GAAAAGCTGGCTCTTGGAAATTGAGCGGAGAGCGACGCGGTTGTTGTAGCTGCCGCTGCG
HKR394078 RBd85D06 pGCAP10 NM_001786.3  
GGCACTTGGCTTCAAAGCTGGCTCTTGGAAATTGAGCGGAGAGCGACGCGGTTGTTGTAG
HKR471150 RBdS177O14 pGCAP10 NM_001786.3  
GGCTGGCTCTTGGAAATTGAGCGGAGAGCGACGCGGTTGTTGTAGCTGCCGCTGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.11.09

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl