Prev. |  KEGG KO K06537 > 

RIKEN DNA Bank Human Resource - CD151

Gene ID NCBI Gene 977 |  KEGG hsa:977
Gene Symbol CD151
Protein Name CD151 molecule (Raph blood group)
Synonyms GP27|MER2|PETA-3|RAPH|SFA1|TSPAN24
Ortholog resources KEGG ortholog (KEGG orthology K06537) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07643 pTarget-hCD151

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081763 IRAL004G19 pOTB7 BC001374 NM_139030 Full
HGY084001 IRAL010A01 pOTB7 BC013302 NM_139030 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013390 W01A033H22 pENTR-TOPO flj0060e12 AK130369 NM_139030  
HGE013392 W01A033H24 pENTR-TOPO flj0060e12 AK130369 NM_139030  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040908 ARe02E12 pKA1U5 NM_004357.4  
GAGCTGCCGCCGCCGCCAGGGCCCGGTACTCGGACGCGTTGCCTAGAGTCCTGGGGAGCT
HKR042427 ARe06B03 pKA1U5 NM_004357.4  
GTCGGACGCGTGGTAGCCCCAGGTATGGGTGAGCTTCAACGAGAAGAAGACAACATGTGG
HKR046034 ARe15B10 pKA1U5 NM_004357.4  
GAGCGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGC
HKR049697 ARe24E01 pKA1U5 NM_004357.4  
GGGGCCGCGCATTCTCAGCGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGG
HKR050171 ARe25H03 pKA1U5 NM_004357.4  
GAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAG
HKR051778 ARe29H10 pKA1U5 NM_004357.4  
TGGGGACGCGTGGTAGCCTAGAGTCCTGGGGAGCTTCTGTCCACCTGTCCTGCAGAGGAG
HKR060029 ARe50B05 pKA1U5 NM_004357.4  
GAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGCCTAGA
HKR066569 ARe66H01 pKA1U5 NM_004357.4  
GGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTG
HKR072125 ARe80F05 pKA1U5 NM_004357.4  
GGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAGC
HKR073211 ARe83A11 pKA1U5 NM_004357.4  
GAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAG
HKR077329 ARe93F09 pKA1U5 NM_004357.4  
GGCCGCCGCCAGGGACCCGGACTCGGACGCGTTGGCTAGCCTAGAGTCCTGGGGAGCTTC
HKR162026 ARi05B02 pGCAP10 NM_004357.4  
GGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAGC
HKR162977 ARi07H09 pGCAP10 NM_004357.4  
TGGACTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAGCTTCTGTCCACCTGTCCTGCAGA
HKR163282 ARi08D10 pGCAP10 NM_004357.4  
GGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTG
HKR164831 ARi12B07 pGCAP10 NM_004357.4  
GGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAGCTTC
HKR167677 ARi19D05 pGCAP10 NM_004357.4  
GGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCCCAGGATGGGTGAGTTCAA
HKR169253 ARi23C05 pGCAP10 NM_004357.4  
GATTCTCAGCGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTC
HKR169660 ARi24C12 pGCAP10 NM_004357.4  
GGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTG
HKR174178 ARi35H10 pGCAP10 NM_004357.4  
GTCTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAGCTTCTGTCCACCTGTCCTGCAGAGG
HKR178007 ARi45A07 pGCAP10 NM_004357.4  
GGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTG
HKR186879 ARi67D07 pGCAP10 NM_004357.4  
GAGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCCCAGGATGGGTG
HKR187297 ARi68E01 pGCAP10 NM_004357.4  
GATTCTCAGCGCTGGGAGCCGCCGCCCCGCAGCTGCCNCGCCGCCANGCCCGNCTCGGAC
HKR188121 ARi70F01 pGCAP10 NM_004357.4  
GAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCC
HKR203241 ARiS008B17 pGCAP10 NM_004357.4  
GGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAGCTTC
HKR205433 ARiS013J17 pGCAP10 NM_004357.4  
GGCCAGGGCCCGGACTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAGCTTCTGTCCACCT
HKR205554 ARiS013O18 pGCAP10 NM_004357.4  
GGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCCCAG
HKR209219 ARiS023A19 pGCAP10 NM_004357.4  
HKR209420 ARiS023J04 pGCAP10 NM_004357.4  
GGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCCCAGGATGGGTGAGTTCAA
HKR235020 ARiS087J04 pGCAP10 NM_004357.4  
GCGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGCCTAGA
HKR235385 ARiS088H17 pGCAP10 NM_004357.4  
GGCCGCGCATTCTCAGCGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCC
HKR243764 ARiS109G20 pGCAP10 NM_004357.4  
GGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTG
HKR243774 ARiS109H06 pGCAP10 NM_004357.4  
GGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTA
HKR243883 ARiS109L19 pGCAP10 NM_004357.4  
GCCGCGCATTCTCAGCGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCC
HKR279330 ARiS198F10 pGCAP10 NM_004357.4  
GATTCTCAGCGCTGGGAGCCGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTC
HKR279495 ARiS198M07 pGCAP10 NM_004357.4  
GAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCTAGAGTCCTGGGGAG
HKR324156 RBb10G12 pKA1U5 NM_004357.4  
AGCTGCTGCCGCCGCCGCCAGGGCCCGGACTCNGANGCGATGGTAGCCCCAGGATGGGTG
HKR324980 RBb12H12 pKA1U5 NM_004357.4  
GGCCGCCCCCGCAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCCCAG
HKR474881 RBdS187D09 pGCAP10 NM_004357.4  
GAGCTGCCGCCGCCGCCAGGGCCCGGACTCGGACGCGTGGTAGCCCCAGGATGGGTGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl