Prev. |  KEGG KO K06501 > 

RIKEN DNA Bank Human Resource - CD68

Gene ID NCBI Gene 968 |  KEGG hsa:968
Gene Symbol CD68
Protein Name CD68 molecule
Synonyms GP110|LAMP4|SCARD1
Featured content Lysosome (human)
Ortholog resource in our bank

  CD68

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081605 IRAL004A05 pOTB7 BC015557 NM_001251 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006114 W01A015E18 pENTR-TOPO IRAL004A05 BC015557 NM_001251  
HGE006116 W01A015E20 pENTR-TOPO IRAL004A05 BC015557 NM_001251  
HGE006118 W01A015E22 pENTR-TOPO IRAL004A05 BC015557 NM_001251  
HGE006120 W01A015E24 pENTR-TOPO IRAL004A05 BC015557 NM_001251  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042948 ARe07G04 pKA1U5 NM_001251.2  
GAGACAGCCTAGCTGGACTTTGGGTGAGGCGGCCTCTTNCATGAGGCTGGCTGTGCTTTT
HKR068032 ARe70B08 pKA1U5 NM_001251.2  
TGGATTTCCTCCTTTCCAAGAGAGGGCTGAGGGAGCAGGGTTGAGCAACTGGTGCAGACA
HKR183602 ARi59A02 pGCAP10 NM_001251.2  
GCTCCTTTCCAAGAGAGGGCTGAGGGAGCAGGGTTGAGCAACTGGTGCAGACAGCCTAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl