Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CD63

Gene ID (NCBI) 967
Gene Symbol CD63
Protein Name CD63 molecule
Synonyms LAMP-3|ME491|MLA1|OMA81H|TSPAN30
Databases KEGG hsa:967 |  NCBI Gene 967
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06497)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080418 IRAL001A18 pOTB7 BC002349 NM_001780 Full
HGY084306 IRAL010M18 pOTB7 BC013017 NM_001780 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004962 W01A012G18 pENTR-TOPO IRAL001A18 BC002349 NM_001780  
HGE004996 W01A012I04 pENTR-TOPO IRAL010M18 BC013017 NM_001780  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047225 ARe18B01 pKA1U5 NM_001780.4  
GAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGC
HKR164923 ARi12F03 pGCAP10 NM_001780.4  
GAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGC
HKR048547 ARe21G03 pKA1U5 NM_001780.4  
GAGAGAGCCCCGGANCCGCGGCGGGTAGAGGAACGCNCAGCCAGCCTTGGGAAGCCCAGG
HKR049210 ARe23A10 pKA1U5 NM_001780.4  
ATCCTGAAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGC
HKR051703 ARe29E07 pKA1U5 NM_001780.4  
GGGGGGGCGCAGCTAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTT
HKR168877 ARi22D05 pGCAP10 NM_001780.4  
GGCAGCTAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGC
HKR052948 ARe32G04 pKA1U5 NM_001780.4  
ATCCTGTAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGC
HKR055329 ARe38F09 pKA1U5 NM_001780.4  
GAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGC
HKR055725 ARe39F05 pKA1U5 NM_001780.4  
GAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGC
HKR173351 ARi33G07 pGCAP10 NM_001780.4  
CGGCCGGCCGATGAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTG
HKR177257 ARi43C09 pGCAP10 NM_001780.4  
GGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGCC
HKR064832 ARe62B08 pKA1U5 NM_001780.4  
GAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGCCCGGCAGCCATGGCGGTGGAAGGA
HKR071681 ARe79D09 pKA1U5 NM_001780.4  
GAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGC
HKR077349 ARe93G05 pKA1U5 NM_001780.4  
GAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGC
HKR203438 ARiS008J22 pGCAP10 NM_001780.4  
GACATGAGGGAGGCCGGCGGCCACTCGGCGGGGGAGGGGACCGTGGCTGGAGCCCGGGGC
HKR209295 ARiS023D23 pGCAP10 NM_001780.4  
GGGAGCCGCGGCGGGANANGAACGCGCANCCNGCCTTGGGAAGCCCAGGCCCGGCAGCCA
HKR222223 ARiS055J07 pGCAP10 NM_001780.4  
GAATCCCCCCGCCCTCCCCTCTGCCCCANGCCCGGCAGCCATGGCGGTGGAAGGAGGAAT
HKR234934 ARiS087F14 pGCAP10 NM_001780.4  
GGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGCCCGGCAGCCA
HKR235100 ARiS087M12 pGCAP10 NM_001780.4  
GAGGCCCGGCAGCCATGGCGGTGGAAGGAGGAATGAAATGTGTGAAGTTCTTGCTCTACG
HKR235332 ARiS088F12 pGCAP10 NM_001780.4  
GAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGC
HKR238453 ARiS096C05 pGCAP10 NM_001780.4  
GAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGC
HKR260124 ARiS150F04 pGCAP10 NM_001780.4  
CGGCCGGCCGATAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGG
HKR277801 ARiS194I09 pGCAP10 NM_001780.4  
GCCCGGANCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGCCCGGCAG
HKR368572 RBd21H04 pGCAP10 NM_001780.4  
TGAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGG
HKR333606 RBb34A06 pGCAP1 NM_001780.4  
GGCAGCTAGAGAGCCCCGGAGCCGCGGCGGGTAGAGGAACGCGCAGCCAGCCTTGGGAAG
HKR337752 RBb44G08 pGCAP1 NM_001780.4  
AAATGTGGGGGGGGCGCAGCTAGAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGC
HKR341351 RBb53G07 pGCAP1 NM_001780.4  
TGGCTTCCTCCCCTTTTCTCAGACTAGGATCCCTGGAAAATGGAGAAGCTGTGCTAATAG
HKR345250 RBb63C02 pGCAP1 NM_001780.4  
GCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGCCTGTGCA
HKR388099 RBd70E03 pGCAP10 NM_001780.4  
GGACCGTGGCTGGAGCCCGGGGCGGGGCCGCGCGGCAGGCGGGGCGGGAGCCGGGGGGCG
HKR395631 RBd89B07 pGCAP10 NM_001780.4  
GGGCCACTCGGCGGGGGAGGGGACCGTGGCTGGAGCCCGGGGCGGGGCCGCGCGGCAGGC
HKR471092 RBdS177M04 pGCAP10 NM_001780.4  
GAGAGCCCCGGAGCCGCGGCGGGAGAGGAACGCGCAGCCAGCCTTGGGAAGCCCAGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl