Prev. |  KEGG KO K04008 > 

RIKEN DNA Bank Human Resource - CD59

Gene ID NCBI Gene 966 |  KEGG hsa:966
Gene Symbol CD59
Protein Name CD59 molecule (CD59 blood group)
Synonyms 16.3A5|1F5|EJ16|EJ30|EL32|G344|HRF-20|HRF20|MAC-IP|MACIF|MEM43|MIC11|MIN1|MIN2|MIN3|MIRL|MSK21|p18-20
Ortholog resources KEGG ortholog (KEGG orthology K04008) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07588 pTarget-hCD59 Expression vector of human CD59

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081325 IRAL003F05 pOTB7 BC001506 NM_203331 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042849 ARe07C01 pKA1U5 NM_000611.5  
GAAATGCTTCCTCGAGGACTGGAAGAGGATCCTGNGCNCCCCCNGGATTCTGTGGACAAT
HKR065305 ARe63E09 pKA1U5 NM_000611.5  
GGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGATTCTGTGGACAATCACAATGG
HKR072829 ARe82B05 pKA1U5 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCAC
HKR073282 ARe83D10 pKA1U5 NM_000611.5  
GGGGGGCTGAGCGCAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTC
HKR166050 ARi15C02 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCAC
HKR166432 ARi16B08 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGTCTTTAGCACCAGTTGG
HKR167732 ARi19F12 pGCAP10 NM_000611.5  
GGGCTGAGCGCAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGT
HKR170809 ARi27A09 pGCAP10 NM_000611.5  
GCCTGGAGCCTTCATCCCTAAGTCAACACCAGGAGAGCTTCTCCCAAACTCCCCGTTCCT
HKR171355 ARi28G11 pGCAP10 NM_000611.5  
GGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCACA
HKR174812 ARi37A12 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCAC
HKR176571 ARi41H03 pGCAP10 NM_000611.5  
GGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCACA
HKR178858 ARi47C10 pGCAP10 NM_000611.5  
GGCAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATC
HKR180527 ARi51F07 pGCAP10 NM_000611.5  
GGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCACAATGGG
HKR180950 ARi52G06 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCAC
HKR181277 ARi53D05 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCAC
HKR183229 ARi58B05 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCNGGTTCTGTGGACAATCAC
HKR203336 ARiS008F16 pGCAP10 NM_000611.5  
GAGAANCNGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCAC
HKR203359 ARiS008G15 pGCAP10 NM_000611.5  
TGGAANCNNCTCNNNNNTGGAAGAGGATCCTGGGCGCCGCCAGTCTTTAGCACCAGTTGG
HKR205303 ARiS013E07 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCAC
HKR209511 ARiS023M23 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGTCTTTAGCACCAGTTGG
HKR218150 ARiS045G06 pGCAP10 NM_000611.5  
GGCAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGTCTTTAGCACCAGTT
HKR218351 ARiS045O15 pGCAP10 NM_000611.5  
HKR243777 ARiS109H09 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGTCTTTAGCACCAGTTGG
HKR243934 ARiS109N22 pGCAP10 NM_000611.5  
TGGAAGCGGCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGTCTTTAGCACCAGTTGG
HKR247542 ARiS118O06 pGCAP10 NM_000611.5  
GAGAAGCGNCTCGAGGCTGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATCAC
HKR279505 ARiS198M17 pGCAP10 NM_000611.5  
GGCAGANGCGGCTCGAGGCNGGAAGAGGATCCTGGGCGCCGCCAGGTTCTGTGGACAATC
HKR390077 RBd75D05 pGCAP10 NM_000611.5  
GAGAAGCGGCTCGAGGCTGGAAGAGGATCTTGGGCGCCGCCAGGTTCTGTGGACAATCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl