DNA Bank Top |  KEGG KO K06266 > 

RIKEN DNA Bank Human Resource - CD47

Gene ID NCBI Gene 961 |  KEGG hsa:961
Gene Symbol CD47
Protein Name CD47 molecule
Synonyms IAP|MER6|OA3
Featured content Extracellular matrix (ECM) - human

Link

Ortholog resource in our bank

  CD47


External database

human CD47

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07584 pcDNA3-hCD47    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018933 IRAK047F13 pBluescriptR BC037306 NM_198793 Full
HGX008451 IRAK021C03 pCMV-SPORT6 BC012884 NM_198793 Full
HGY028555 IRAK071G11 pBluescriptR BC042889 NM_001777 Partial
HGY042715 IRAK106N03 pBluescript BC045593 NM_198793 Partial/var
HGY090780 IRAL026P20 pOTB7 BC010016 NM_198793 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090006 M01C025A06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090054 M01C025C06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090102 M01C025E06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090150 M01C025G06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090198 M01C025I06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090246 M01C025K06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090294 M01C025M06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090342 M01C025O06 pDONR221 MGC02-B03 BC037306 NM_198793  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164121 ARi10F01 pGCAP10 NM_001777.3  
GGGTCGGTCCTGCCTGTAACGGCGGCGGCGGCTGCTGCTCCAGACACCTGCGGCGGCGGC
HKR166475 ARi16D03 pGCAP10 NM_001777.3  
GAGACGTCTGCGCGCGAATGCCGTGGCGCGAACTTGGGACTGCAGAGGCGCGCCTGGCGG
HKR167375 ARi18H07 pGCAP10 NM_001777.3  
GCTGGGCAGTGGGTCCTGCCTGTGACGCGCGGCGGCGGTCGGCCCTGCCTGTAACGGCGG
HKR344904 RBb62E08 pGCAP1 NM_001777.3  
TTTTTTGCGGCGGTCGGTCCTGCCTGTAACGGCGGCGGCGGCTGCTGCTCCAGACACCTG
HKR374108 RBd35E12 pGCAP10 NM_001777.3  
GAGACACCTGCGGCGGCGGCGGCGACCCCGCGGCGGGCGCGGAGATGTGGCCCCTGGTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl