Prev. |  KEGG KO K06266 > 

RIKEN DNA Bank Human Resource - CD47

Gene ID NCBI Gene 961 |  KEGG hsa:961
Gene Symbol CD47
Protein Name CD47 molecule
Synonyms IAP|MER6|OA3
Ortholog resources KEGG ortholog (KEGG orthology K06266) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07584 pcDNA3-hCD47

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008451 IRAK021C03 pCMV-SPORT6 BC012884 NM_198793 Full
HGY018933 IRAK047F13 pBluescriptR BC037306 NM_198793 Full
HGY028555 IRAK071G11 pBluescriptR BC042889 NM_001777 Partial
HGY042715 IRAK106N03 pBluescript BC045593 NM_198793 Partial/var
HGY090780 IRAL026P20 pOTB7 BC010016 NM_198793 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE090006 M01C025A06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090054 M01C025C06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090102 M01C025E06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090150 M01C025G06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090198 M01C025I06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090246 M01C025K06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090294 M01C025M06 pDONR221 MGC02-B03 BC037306 NM_198793  
HGE090342 M01C025O06 pDONR221 MGC02-B03 BC037306 NM_198793  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164121 ARi10F01 pGCAP10 NM_001777.3  
GGGTCGGTCCTGCCTGTAACGGCGGCGGCGGCTGCTGCTCCAGACACCTGCGGCGGCGGC
HKR166475 ARi16D03 pGCAP10 NM_001777.3  
GAGACGTCTGCGCGCGAATGCCGTGGCGCGAACTTGGGACTGCAGAGGCGCGCCTGGCGG
HKR167375 ARi18H07 pGCAP10 NM_001777.3  
GCTGGGCAGTGGGTCCTGCCTGTGACGCGCGGCGGCGGTCGGCCCTGCCTGTAACGGCGG
HKR344904 RBb62E08 pGCAP1 NM_001777.3  
TTTTTTGCGGCGGTCGGTCCTGCCTGTAACGGCGGCGGCGGCTGCTGCTCCAGACACCTG
HKR374108 RBd35E12 pGCAP10 NM_001777.3  
GAGACACCTGCGGCGGCGGCGGCGACCCCGCGGCGGGCGCGGAGATGTGGCCCCTGGTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl