Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SCARB2

Gene ID (NCBI) 950
Gene Symbol SCARB2
Protein Name scavenger receptor class B member 2
Synonyms AMRF|CD36L2|EPM4|HLGP85|LGP85|LIMP-2|LIMPII|SR-BII
Databases KEGG hsa:950 |  NCBI Gene 950
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12384)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005465 IRAK013L01 pCMV-SPORT6 BC021892 NM_005506 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR170149 ARi25G05 pGCAP10 NM_005506.2  
GGGCCCGGCCCGGCCCGTGAGCGGCGCACAGAATGGGCCGATGCTGCTTCTACACGGCGG
HKR061260 ARe53C12 pKA1U5 NM_005506.2  
GCCTTGCAGTTGGATCCCTGGCGGGTGCGGCCCGGCCCGGCCCGTGAGCGGCGCACAGAA
HKR066152 ARe65G08 pKA1U5 NM_005506.2  
GGGCCCGGCCCGTGAGCGGCGCACAGAATGGGCCGATGCTGCTTCTACACGGCGGGGACG
HKR238608 ARiS096I16 pGCAP10 NM_005506.2  
GCCTTCCTTGCAGTTGGATCCCTGGCGGGTGCGGCCCGGCCCGGCCCGTGAGCGGCGCAC
HKR276616 ARiS191I24 pGCAP10 NM_005506.2  
GGCCTCTGCGGCGGCTCCTCCCTCCTTGCAGTTGGATCCCTGGCGGGTGCGGCCCGGCCC
HKR277659 ARiS194C11 pGCAP10 NM_005506.2  
GGTGAGCGGCGCACAGAATGGGCCGATGCTGCTTCTACACGGCGGGGACGTTGTCCCTGC
HKR370032 RBd25B08 pGCAP10 NM_005506.2  
GTGCGGCCCGGCCCGGCCCGTGAGCGGCGCACAGAATGGGCCGATGCTGCTTCTACACGG
HKR379728 RBd49F08 pGCAP10 NM_005506.2  
GAGTTGGATCCCTGGCGGGTGCGGCCCGGCCCGGCCCGTGAGCGGCGCACAGAATGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl