Prev. |  KEGG KO K13885 > 

RIKEN DNA Bank Human Resource - SCARB1

Gene ID NCBI Gene 949 |  KEGG hsa:949
Gene Symbol SCARB1
Protein Name scavenger receptor class B member 1
Synonyms CD36L1|CLA-1|CLA1|HDLQTL6|SR-BI|SRB1
Ortholog resource in our bank

  SCARB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07642 pcDNA3.1(-)-h SCAR B1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY103931 IRAL059N19 pOTB7 BC080647 NM_005505 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023849 W01A059K09 pENTR-TOPO IRAL059N19 BC080647 NM_005505  
HGE023851 W01A059K11 pENTR-TOPO IRAL059N19 BC080647 NM_005505  
HGE023853 W01A059K13 pENTR-TOPO IRAL059N19 BC080647 NM_005505  
HGE023855 W01A059K15 pENTR-TOPO IRAL059N19 BC080647 NM_005505  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081636 ARf04B12 pKA1U5 NM_005505.4  
GGGTCCGGCGGCGCCGGCGATGGGGCATAAAACCACTGGCCACCTGCCGGGCTGCTCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl