Prev. |  KEGG KO K06460 > 

RIKEN DNA Bank Human Resource - CD9

Gene ID NCBI Gene 928 |  KEGG hsa:928
Gene Symbol CD9
Protein Name CD9 molecule
Synonyms BTCC-1|DRAP-27|MIC3|MRP-1|TSPAN-29|TSPAN29
Ortholog resource in our bank

  CD9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04979 pAxCALNLhCD9(forward) Shuttle vector to generate rAd expressing human CD9
RDB04980 pAxCALNLhCD9(reverse) Shuttle vector to generate rAd expressing human CD9
RDB05018 pAxCALNLhCD9(forward) Shuttle vector to generate rAd expressing human CD9
RDB05019 pAxCALNLhCD9(reverse) Shuttle vector to generate rAd expressing human CD9
RDB05096 pAxCALNLhCD9(forward) Shuttle vector to generate rAd expressing human CD9
RDB05097 pAxCALNLhCD9(reverse) Shuttle vector to generate rAd expressing human CD9

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008517 IRAK021E21 pCMV-SPORT6 BC011988 NM_001769 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061210 ARe53A10 pKA1U5 NM_001769.2  
GGGCACTTTTTAAAAGTGCAGCCGGAGACCAGCCTACAGCCGCCTGCATCTGTATCCAGC
HKR180434 ARi51B10 pGCAP10 NM_001769.2  
GAAAAGTGCAGCCGGAGACCAGCCTACAGCCGCCTGCATCTGTATCCAGCGCCAGGTCCC
HKR182029 ARi55B05 pGCAP10 NM_001769.2  
GAGCCGGAGACCAGCCTACAGCCGCCTGCATCTGTATCCAGCGCCAGGTCCCGCCAGTCC
HKR388008 RBd70A08 pGCAP10 NM_001769.2  
GGGCACTTTTTAAAAGTGCAGCCGGAGACCAGCCTACAGCCGCCTGCATCTGTATCCAGC
HKR474802 RBdS187A02 pGCAP10 NM_001769.2  
GGGCACATGCGCACCGCAGCGGGTCGCGCGCCCTAAGGAGTGGCACTTTTTAAAAGTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl