Prev. |  KEGG KO K09498 > 

RIKEN DNA Bank Human Resource - CCT6A

Gene ID NCBI Gene 908 |  KEGG hsa:908
Gene Symbol CCT6A
Protein Name chaperonin containing TCP1 subunit 6A
Synonyms CCT-zeta|CCT-zeta-1|CCT6|Cctz|HTR3|MoDP-2|TCP-1-zeta|TCP20|TCPZ|TTCP20
Ortholog resources KEGG ortholog (KEGG orthology K09498) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041260 ARe03C12 pKA1U5 NM_001762.3  
ATCCTGGGGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTTTCCTCCGCTG
HKR177772 ARi44H04 pGCAP10 NM_001762.3  
GAGAAGACCCGGATAGTTCCTCCCGGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGT
HKR180101 ARi50E05 pGCAP10 NM_001762.3  
GGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTTTCCTCCGCTGGAGCAGCTATGG
HKR203546 ARiS008O10 pGCAP10 NM_001762.3  
GGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTTTCCTCCGCTGGAGCAGCTATGG
HKR234189 ARiS085H21 pGCAP10 NM_001762.3  
GGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTTTCCTCCGCTGGAGCAGC
HKR235393 ARiS088I01 pGCAP10 NM_001762.3  
GCCCCGGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTTTCCTCCGCTGGA
HKR330076 RBb25D04 pGCAP1 NM_001762.3  
AGAAGACCCGGATAGTTCCTCCCGGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGTT
HKR336806 RBb42A06 pGCAP1 NM_001762.3  
GCTNCAGCAANACCCGGCANAGTTCCTCCCGGCCACGCCNTCGCCGGTCTCTGG
HKR376179 RBd40H11 pGCAP10 NM_001762.3  
GCCCGGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTTTCCTCCGCTGGAG
HKR387283 RBd68D11 pGCAP10 NM_001762.3  
GCCGGATAGTTCCTCCCGGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTT
HKR398881 RBd97D09 pGCAP10 NM_001762.3  
GCCTTTTCCTCCGCTGGAGCAGCTATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAG
HKR408855 RBdS022C07 pGCAP10 NM_001762.3  
GGGCCAGACGGGCCGACTTTTCCAGAAGACCCGGATAGTTCCTCCCGGCCACGCCGCGCC
HKR428296 RBdS070M08 pGCAP10 NM_001762.3  
TAGAAGACCCGGATAGTTCCTCCCGGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGT
HKR433225 RBdS083B01 pGCAP10 NM_001762.3  
GACTCAGCATCGTTTCCTTTTCCTCCGCTGGAGCAGCTATGGCGGCGGTGAAGACCCTGA
HKR433337 RBdS083F17 pGCAP10 NM_001762.3  
GGGCCACGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTTTCCTCCGCTGGAGCAG
HKR433522 RBdS083N10 pGCAP10 NM_001762.3  
GGCATCGTTTCCTTTTCCTCCGCTGGAGCAGCTATGGCGGCGGTGAAGACCCTGAACCCC
HKR452973 RBdS132H05 pGCAP10 NM_001762.3  
TGGCCGCGCCGGCTCTGGGCACTCAGCATCGTTTCCTTTTCCTCCGCTGGAGCAGCTATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl