Prev. |  KEGG KO K10146 > 

RIKEN DNA Bank Human Resource - CCNG2

Gene ID NCBI Gene 901 |  KEGG hsa:901
Gene Symbol CCNG2
Protein Name cyclin G2
Synonyms -
Ortholog resource in our bank

  CCNG2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027715 IRAK069E19 pCMV-SPORT6 BC032518 NM_004354

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR390947 RBd77G03 pGCAP10 NM_004354.1  
GGCTGAGGCGGCGGGGGTGCGGCGGTGGGCTGGTCTTCCGCGGCCGGCGTTGCGCCGCGG
HKR392924 RBd82F04 pGCAP10 NM_004354.1  
TGGGAGGCGGCGGGGGTGCGGCGGTGGGCTGGTCTTCCGCGGCCGGCGTTGCGCCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl