Prev. |  KEGG KO K10145 > 

RIKEN DNA Bank Human Resource - CCNG1

Gene ID NCBI Gene 900 |  KEGG hsa:900
Gene Symbol CCNG1
Protein Name cyclin G1
Synonyms CCNG
Ortholog resources KEGG ortholog (KEGG orthology K10145) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082509 IRAL006E13 pOTB7 BC000196 NM_199246 Full
HGY088508 IRAL021E12 pDNR-LIB BC007093 NM_199246 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE043251 W01A108C03 pENTR-TOPO IRAL021E12 BC007093 NM_199246  
HGE043255 W01A108C07 pENTR-TOPO IRAL021E12 BC007093 NM_199246  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041378 ARe03H10 pKA1U5 NM_004060.3  
GCCCTTCGGCTCCGAGCTGACCCTGATCAGGGCCGANNTTGTCTCGGCGGCGCTGCCGAG
HKR070030 ARe75B06 pKA1U5 NM_004060.3  
TGCCCTTCGGCTCCGAGCTGACCCTGATCAGGGCCGAGATTGTCTCGGCGGCGCTGCCGA
HKR075329 ARe88F09 pKA1U5 NM_004060.3  
GGGCTCCGAGCTGACCCTGATCAGGGCCGAGTTGTCTCGGCGGCGCTGCCGAGGCCTCCA
HKR075702 ARe89E06 pKA1U5 NM_004060.3  
CCTTCGGCTCCGAGCTGACCCTGATCAGGGCCGAGTTGTCTCGGCGGCGCTGCCGAGGCC
HKR080806 ARf02A06 pKA1U5 NM_004060.3  
GCCCTTCGGCTCCGAGCTGACCCTGNATCAGGGCCGAGATTGTCTCGGCGGCGCTGCCGA
HKR170098 ARi25E02 pGCAP10 NM_004060.3  
GTCGGCTCCGAGCTGACCCTGATCAGGGCCGAGTTGTCTCGGCGGCGCTGCCGAGGCCTC
HKR185677 ARi64D05 pGCAP10 NM_004060.3  
HKR209530 ARiS023N18 pGCAP10 NM_004060.3  
GCCCTTCGGCTCCGAGCTGACCCTGATCAGGGCCGAGTTGTCTCGGCGGCGCTGCCGAGG
HKR324011 RBb10A11 pKA1U5 NM_004060.3  
GCCTTCGGCTCCGAGCTGACCCTGATCAGGGCCGAGTTTGTCTCGGCGGCGCTGCCGAGG
HKR360576 RBd01H08 pGCAP10 NM_004060.3  
GGCCCTTCGGCTCCGAGCTGACCCTGATCAGGGCCGAGTTGTCTCGGCGGCGCTGCCGAG
HKR366829 RBd17B05 pGCAP10 NM_004060.3  
GCCCTTCGGCTCCGAGCTGACCCTGATCAGGGCCGAGTTGTCTCGGCGGCGCTGCCGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl