Prev. |  KEGG KO K10152 > 

RIKEN DNA Bank Human Resource - CCND3

Gene ID NCBI Gene 896 |  KEGG hsa:896
Gene Symbol CCND3
Protein Name cyclin D3
Synonyms -
Featured content DNA damage
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)
Featured content Jak-STAT signaling pathway (human)
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  CCND3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086317 IRAL015N05 pOTB7 BC011616 NM_001760 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372836 RBd32B12 pGCAP10 NM_001760.3  
GGCTGGGGATCCGCCGCGCAGTGCCAGCGCCAGCGCCAGACCCGCGCCCCGCGCTCTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl