Prev. |  KEGG KO K15161 > 

RIKEN DNA Bank Human Resource - CCNC

Gene ID NCBI Gene 892 |  KEGG hsa:892
Gene Symbol CCNC
Protein Name cyclin C
Synonyms CycC|SRB11|hSRB11
Ortholog resource in our bank

  CCNC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044292 IRAK110M04 pCMV-SPORT6 BC050726 NM_005190 Full
HGX047905 IRAK119M17 pCMV-SPORT6 BC056153 NM_005190 Full
HGY091090 IRAL027M02 pOTB7 BC010135 NM_005190 Full
HGY095915 IRAL039N03 pOTB7 BC030159 NM_005190 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE029097 W01A072M09 pENTR-TOPO IRAK119M17 BC056153 NM_005190  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR321749 RBb04G05 pKA1U5 NM_005190.3  
GGATCGAGGAGCGCGGTTACCGGACGGGCTGGNCTCTATGGTCGCTCCGCGGGCCGCTCC
HKR379253 RBd48C05 pGCAP10 NM_005190.3  
TGGGAGTCGAGCCGAGCTGATTTGATCGAGGAGCGCGGTTACCGGACGGGCTGGGTCTAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl