Prev. |  KEGG KO K06627 > 

RIKEN DNA Bank Human Resource - CCNA2

Gene ID NCBI Gene 890 |  KEGG hsa:890
Gene Symbol CCNA2
Protein Name cyclin A2
Synonyms CCN1|CCNA
Ortholog resources KEGG ortholog (KEGG orthology K06627) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03595 pAxCALNLhCyclin A2 (forward) Shuttle vector to generate rAd harboring human Cyclin A2 (forward)
RDB04162 pAxCALNLhCyclin A2 (reverse) Shuttle vector to generate rAd harboring human Cyclin A2
RDB06665 pCMFlag_hsCCNA2 Expression vector of human CCNA2/Cyclin A2.

RDB_org_190226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049653 ARe24C05 pKA1U5 NM_001237.3  
GTCTTTGGCTCGCCACGCTGGGCAGTGCCTGCCTGCGCCTTTCGCAACCTCCTCGGCCCT
HKR077683 ARe94D11 pKA1U5 NM_001237.3  
GAGCCGCCGCTCCGGCGGGCTGCTCGCTGCATCTCTGGGCGTCTTTGGCTCGCCACGCTG
HKR082879 ARf07D07 pKA1U5 NM_001237.3  
GGGGATACTTGAACTGCAAGAACAGCCGCCGCTCCGGCGGGCTGCTCGCTGCATCTCTGG
HKR187732 ARi69F12 pGCAP10 NM_001237.3  
GGATACTTGAACTGCAAGAACAGCCGCCGCTCCGGCGGGCTGCTCGCTGCATCTCTGGGC
HKR279221 ARiS198A21 pGCAP10 NM_001237.3  
HKR332951 RBb32G07 pGCAP1 NM_001237.3  
GTCTCGCTGCATCTCTGGGCGTCTTTGGCTCGCCACGCTGGGCAGTGCCTGCCTGCGCCT
HKR362579 RBd06H11 pGCAP10 NM_001237.3  
GAATAGTCGCGGGATACTTGAACTGCAAGAACAGCCGCCGCTCCGGCGGGCTGCTCGCTG
HKR366054 RBd15C06 pGCAP10 NM_001237.3  
GGGGCGTCTTTGGCTCGCCACGCTGGGCAGTGCCTGCCTGCGCCTTTCGCAACCTCCTCG
HKR397702 RBd94E06 pGCAP10 NM_001237.3  
GGGGATACTTGAACTGCAAGAACAGCCGCCGCTCCGGCGGGCTGCTCGCTGCATCTCTGG
HKR444002 RBdS110A02 pGCAP10 NM_001237.3  
GACGCTGGGCAGTGCCTGCCTGCGCCTTTCGCAACCTCCTCGGCCCTGCGTGGTCTTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl