Prev. |  KEGG KO K01697 > 

RIKEN DNA Bank Human Resource - CBS

Gene ID NCBI Gene 875 |  KEGG hsa:875
Gene Symbol CBS
Protein Name cystathionine-beta-synthase
Synonyms HIP4
Ortholog resources KEGG ortholog (KEGG orthology K01697) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005413 IRAK013I21 pCMV-SPORT6 BC011381 NM_000071 Full
HGX007740 IRAK019F20 pCMV-SPORT6 BC010242 NM_000071 Full
HGY080481 IRAL001D09 pOTB7 BC000440 NM_000071 Full/var
HGY088920 IRAL022E24 pOTB7 BC007257 NM_000071 Full
HGY089547 IRAL023O11 pOTB7 BC012319 NM_000071 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR323610 RBb09A10 pKA1U5 NM_000071.1  
GGCCGTCTCCGCCTCGCCGCAGTCGGGGCAGCCGCTCGCCCCTCTTTTCCATGTATCCGT
HKR378173 RBd45H05 pGCAP10 NM_000071.1  
GGTCTCCGCCTCGCCGCAGTCGGGGCAGCCGCTCGCCCCTCTTTTCCATGTATCCGTCCA
HKR379607 RBd49A07 pGCAP10 NM_000071.1  
CGGCCGGCCGATGGTCTCCGCCTCGCCGCAGTCGGGGCAGCCGCTCGCCCCTCTTTTCCA
HKR393251 RBd83C03 pGCAP10 NM_000071.1  
GGTCTCCGCCTCGCCGCAGTCGGGGCAGCCGCTCGCCCCTCTTTTCCATGTATCCGTCCA
HKR462783 RBdS156P23 pGCAP10 NM_000071.1  
GGGGGTCGCCGTCTCCGCCTCGCCGCAGTCGGGGCAGCCGCTCGCCCCTCTTTTCCATGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl