Prev. |  KEGG KO K09501 > 

RIKEN DNA Bank Human Resource - SERPINH1

Gene ID NCBI Gene 871 |  KEGG hsa:871
Gene Symbol SERPINH1
Protein Name serpin family H member 1
Synonyms AsTP3|CBP1|CBP2|HSP47|OI10|PIG14|PPROM|RA-A47|SERPINH2|gp46
Ortholog resource in our bank

  SERPINH1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011819 IRAK029J03 pCMV-SPORT6 BC036298 NM_001235 Full
HGY067155 IRAK167O19 pBluescriptR BC070087 NM_001235 Full/var
HGY084278 IRAL010L14 pOTB7 BC014623 NM_001235 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022338 W01A055O02 pENTR-TOPO flj0048p16 AK122936 NM_001235 done
HGE022340 W01A055O04 pENTR-TOPO flj0048p16 AK122936 NM_001235  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044480 ARe11D08 pKA1U5 NM_001235.2  
GCCAGAAGTTTCTCGGGACGGGCAGGAGGGGGTGGGGACTGCCATATATAGATCCCGGGA
HKR174811 ARi37A11 pGCAP10 NM_001235.2  
GGGCTTTTTTTGGCGGAGCTGGGGCGCCCTCCGGAAGCGTTTCCAACTTTCCAGAAGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl