Prev. | 

RIKEN DNA Bank Human Resource - CBFB

Gene ID NCBI Gene 865 |  KEGG hsa:865
Gene Symbol CBFB
Protein Name core-binding factor subunit beta
Synonyms PEBP2B
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE020990 W01A052H22 pENTR-TOPO IRAK013F11 BC018509 NM_001755  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR432526 RBdS081F06 pGCAP10 NM_001755.2  
GGCGGGCGGGCGCCTGAAACAAAGGGAAGCGGGCGTCCGGGCGCCGCGGGTGGGCGGTCA
HKR442137 RBdS105F17 pGCAP10 NM_001755.2  
GGCGGGCGGCAGGCAACGGCTGAGGCGGCGGCGGCGGCGGCGGCGGCGTGGGTTGGGCTC
HKR462423 RBdS156A23 pGCAP10 NM_001755.2  
GGGCCGGGGGCGGTGAGCGCTGGGGCTGCGCGGGCGGCAGGCAACGGCTGAGGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl