Prev. | 

RIKEN DNA Bank Human Resource - CBFA2T3

Gene ID NCBI Gene 863 |  KEGG hsa:863
Gene Symbol CBFA2T3
Protein Name CBFA2/RUNX1 partner transcriptional co-repressor 3
Synonyms ETO2|MTG16|MTGR2|RUNX1T3|ZMYND4
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR368099 RBd20E03 pGCAP10 NM_175931.1  
GGCCACAGGCGCGGCGGCTGGACCCGGCGCGGGCCGCGGAGGCCGGAGACCGCCCCGGGC
HKR453076 RBdS132L12 pGCAP10 NM_175931.1  
GCCCGGCCCCCACGGCCAGTTCTTAGGGCGCCGCCCCGGTGGCGGAGGCGTTGGGGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl