Prev. |  KEGG KO K06278 > 

RIKEN DNA Bank Human Resource - CAV1

Gene ID NCBI Gene 857 |  KEGG hsa:857
Gene Symbol CAV1
Protein Name caveolin 1
Synonyms BSCL3|CGL3|LCCNS|MSTP085|PPH3|VIP21
Featured content Endocytosis (human)
Ortholog resource in our bank

  CAV1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05242 pAxCALNLhCaveolin-1(forward) Shuttle vector to generate rAd expressing human CAV1
RDB05243 pAxCALNLhCaveolin-1(reverse) Shuttle vector to generate rAd expressing human CAV1
RDB05247 pAxCALNLhCaveolin-1(forward) Shuttle vector to generate rAd expressing human CAV1
RDB05248 pAxCALNLhCaveolin-1(reverse) Shuttle vector to generate rAd expressing human CAV1
RDB05256 pAxCALNLhCaveolin-1(forward) Shuttle vector to generate rAd expressing human CAV1
RDB05347 pAxCALNLhCaveolin-1 (forward) Shuttle vector to generate rAd harboring human Caveolin-1 (forward)
RDB07364 pGL4-phCAV1 Promoter collection, Human CAV1 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103735 IRAL059F15 pOTB7 BC082246 NM_001753 Full
HGY087443 IRAL018K03 pOTB7 BC006432 NM_001753 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR077635 ARe94B11 pKA1U5 NM_001753.3  
GCTTCCTCAGTTCCCTTAAAGCACAGCCCAGGGAAACCTCCTCACAGTTTTCATCCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl