DNA Bank Top |  KEGG KO K06278 > 

RIKEN DNA Bank Human Resource - CAV1

Gene ID NCBI Gene 857 |  KEGG hsa:857
Gene Symbol CAV1
Protein Name caveolin 1
Synonyms BSCL3|CGL3|LCCNS|MSTP085|PPH3|VIP21
Featured content Endocytosis (human)

Link

Ortholog resource in our bank

  CAV1

External database

human CAV1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07364 pGL4-phCAV1 Promoter collection, Human CAV1 promoter    
RDB05347 pAxCALNLhCaveolin-1 (forward) Shuttle vector to generate rAd harboring human Caveolin-1 (forward)    
RDB05256 pAxCALNLhCaveolin-1(forward) Shuttle vector to generate rAd expressing human CAV1    
RDB05248 pAxCALNLhCaveolin-1(reverse) Shuttle vector to generate rAd expressing human CAV1    
RDB05247 pAxCALNLhCaveolin-1(forward) Shuttle vector to generate rAd expressing human CAV1    
RDB05243 pAxCALNLhCaveolin-1(reverse) Shuttle vector to generate rAd expressing human CAV1    
RDB05242 pAxCALNLhCaveolin-1(forward) Shuttle vector to generate rAd expressing human CAV1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY103735 IRAL059F15 pOTB7 BC082246 NM_001753 Full
HGY087443 IRAL018K03 pOTB7 BC006432 NM_001753 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077635 ARe94B11 pKA1U5 NM_001753.3  
GCTTCCTCAGTTCCCTTAAAGCACAGCCCAGGGAAACCTCCTCACAGTTTTCATCCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.11.08

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl