Prev. |  KEGG KO K03781 > 

RIKEN DNA Bank Human Resource - CAT

Gene ID NCBI Gene 847 |  KEGG hsa:847
Gene Symbol CAT
Protein Name catalase
Synonyms -
Featured content Amyotrophic lateral sclerosis (ALS) - human
Ortholog resource in our bank

  CAT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010509 IRAK026E13 pCMV-SPORT6 BC027300 NM_001752 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062809 ARe57A09 pKA1U5 NM_001752.2  
GACGAGCCGAGGCCTCCTGCAGTGTTCCGCACAGCAAACCGCACGCTATGGCTGACAGCC
HKR176431 ARi41B07 pGCAP10 NM_001752.2  
GGAGCCTGAAGTCGCCACGGTCTCGGGGCAACAGGCAGATTTGCCTGCTGAGGGTGGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl