Prev. |  KEGG KO K04394 > 

RIKEN DNA Bank Human Resource - CASP4

Gene ID NCBI Gene 837 |  KEGG hsa:837
Gene Symbol CASP4
Protein Name caspase 4
Synonyms ICE(rel)II|ICEREL-II|ICH-2|Mih1|Mih1/TX|TX
Ortholog resource in our bank

  CASP4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05092 pAxCALNLhCASP4(forward) Shuttle vector to generate rAd expressing human CASP4
RDB05093 pAxCALNLhCASP4(reverse) Shuttle vector to generate rAd expressing human CASP4
RDB05117 pAxCALNLhCASP4 (forward) Shuttle vector to generate rAd harboring human CASP4 (forward)
RDB05118 pAxCALNLhCASP4 (reverse) Shuttle vector to generate rAd harboring human CASP4 (reverse)
RDB05127 pAxCALNLhCASP4 (forward) Shuttle vector to generate rAd harboring human CASP4 (forward)
RDB05128 pAxCALNLhCASP4 (reverse) Shuttle vector to generate rAd harboring human CASP4 (reverse)

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094779 IRAL036P19 pDNR-LIB BC017839 NM_033306 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049204 ARe23A04 pKA1U5 NM_001225.3  
TGCCAACGCTGTAAAAAAGGACAGAGGCTGTTCCCTATGGCAGAAGGCAACCACAGAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl