DNA Bank Top |  KEGG KO K02187 > 

RIKEN DNA Bank Human Resource - CASP3

Gene ID NCBI Gene 836 |  KEGG hsa:836
Gene Symbol CASP3
Protein Name caspase 3
Synonyms CPP32|CPP32B|SCA-1
Featured content Apoptosis - human
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Featured content Influenza A relevant genes - human

Link

Ortholog resource in our bank

  CASP3

External database

human CASP3

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14403 pGEX-6P-3/GST-TAT-ODD/3-0-Casp3 Bacterial expression vector of protein prodrug TOP3 that is specifically processed and activated in hypoxia-inducible factor-active cells.    
RDB01985 pAxCALNLhCPP32 Shuttle vector to generate rAd expressing human caspase 3, CPP32    
RDB01984 AxCALNLhCPP32 Recombinant adenovirus expressing human caspase 3, loxP    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011039 IRAK027J23 pCMV-SPORT6 BC016926 NM_032991 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171678 ARi29D06 pGCAP10 NM_004346.3  
GAGTGCAGACGCGGCTCCTAGCGGATGGGTGCTATTGTGAGGCGGTTGTGGAAGAGTTTC
HKR219638 ARiS049B14 pGCAP10 NM_004346.3  
GGCAGACGCGGCTCCTAGCGGATGGGTGCTATTGTGAGGCGGTTGTGGAAGTTAATAAAG
HKR264613 ARiS161I21 pGCAP10 NM_004346.3  
GAGTGCANACGCGGCTCCTAGCGGATGGGTGCTATTGTGAGGCGGTTGTGGAAGTTAATA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl