Prev. |  KEGG KO K02186 > 

RIKEN DNA Bank Human Resource - CASP2

Gene ID NCBI Gene 835 |  KEGG hsa:835
Gene Symbol CASP2
Protein Name caspase 2
Synonyms CASP-2|ICH1|NEDD-2|NEDD2|PPP1R57
Featured content Apoptosis - human
Ortholog resource in our bank

  CASP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082060 IRAL005C12 pOTB7 BC002427 NM_032982 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100042 M01C050B18 pDONR221 MGC14-H09 BC002427 NM_032982  
HGE100090 M01C050D18 pDONR221 MGC14-H09 BC002427 NM_032982  
HGE100138 M01C050F18 pDONR221 MGC14-H09 BC002427 NM_032982  
HGE100186 M01C050H18 pDONR221 MGC14-H09 BC002427 NM_032982  
HGE100234 M01C050J18 pDONR221 MGC14-H09 BC002427 NM_032982  
HGE100282 M01C050L18 pDONR221 MGC14-H09 BC002427 NM_032982  
HGE100330 M01C050N18 pDONR221 MGC14-H09 BC002427 NM_032982  
HGE100378 M01C050P18 pDONR221 MGC14-H09 BC002427 NM_032982  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176811 ARi42A11 pGCAP10 NM_032982.2  
AGGCAGTGTGCGTCCGCGTCTGAGGGGAGGGATGTGGGGGAAGCGACGGCCCCCGGTTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl