Prev. |  KEGG KO K01883 > 

RIKEN DNA Bank Human Resource - CARS1

Gene ID NCBI Gene 833 |  KEGG hsa:833
Gene Symbol CARS1
Protein Name cysteinyl-tRNA synthetase 1
Synonyms CARS|CYSRS|MGC:11246
Ortholog resource in our bank

  CARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13275 pUC-T7-EMCV-GST-CysRS EMCV IRES-dependent expression vector of human cysteinyl-tRNA synthetase

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086147 IRAL015G03 pOTB7 BC002880 NM_139273 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098431 M01C046B07 pDONR221 MGC12-G04 BC002880 NM_001751  
HGE098479 M01C046D07 pDONR221 MGC12-G04 BC002880 NM_001751  
HGE098527 M01C046F07 pDONR221 MGC12-G04 BC002880 NM_001751  
HGE098575 M01C046H07 pDONR221 MGC12-G04 BC002880 NM_001751  
HGE098623 M01C046J07 pDONR221 MGC12-G04 BC002880 NM_001751  
HGE098671 M01C046L07 pDONR221 MGC12-G04 BC002880 NM_001751  
HGE098719 M01C046N07 pDONR221 MGC12-G04 BC002880 NM_001751  
HGE098767 M01C046P07 pDONR221 MGC12-G04 BC002880 NM_001751  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043251 ARe08C03 pKA1U5 NM_139273.2  
GGGTTGCATCAGATTCTAGGAAGTGTCTGTAGCCGCAGCTGCGGGTCCGGGATTCCCAGC
HKR277971 ARiS194P11 pGCAP10 NM_139273.2  
GAATTGAGATTCTNGGAAGTGTCTGTACCCGCNCCTGCGGGTCCGGGANTCCCAGCCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl