Prev. |  KEGG KO K04281 > 

RIKEN DNA Bank Human Resource - CAST

Gene ID NCBI Gene 831 |  KEGG hsa:831
Gene Symbol CAST
Protein Name calpastatin
Synonyms BS-17|PLACK
Ortholog resources KEGG ortholog (KEGG orthology K04281) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005659 IRAK014C11 pCMV-SPORT6 BC013579 NM_173062 Full/var
HGX069771 IRAK174H03 pCMV-SPORT6 BC078149 NM_173061 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076502 ARe91E06 pKA1U5 NM_001750.5  
ATCGAAGGAGGAACGCTGCAACCTCCAACCCCTTCTTTCTGACCAACCGGGACCAGAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl