Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CAPZA2

Gene ID (NCBI) 830
Gene Symbol CAPZA2
Protein Name capping actin protein of muscle Z-line alpha subunit 2
Synonyms CAPPA2|CAPZ
Databases KEGG hsa:830 |  NCBI Gene 830
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10364)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086580 IRAL016H12 pDNR-LIB BC005338 NM_006136 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053275 ARe33D03 pKA1U5 NM_006136.2  
ATCCTGATGGCTGAGGACCGCACGGAAACGGGGAAGTCAGGTGGCCGCTGCCGCCGCCGC
HKR185727 ARi64F07 pGCAP10 NM_006136.2  
HKR078532 ARe96F12 pKA1U5 NM_006136.2  
GAGAAGGAAGATGGCGGATCTGGAGGAGCANATTGTCTGATGAANAGAAGGTGCGTATAG
HKR243954 ARiS109O18 pGCAP10 NM_006136.2  
GTTGTCGCCAGAAGGAAGATGGCGGATCTGGAGGAGCAGTTGTCTGATGAAGAGAAGGTG
HKR379673 RBd49D01 pGCAP10 NM_006136.2  
GGCCGCGGTTTGTCGCCAGAAGGAAGATGGCGGATCTGGAGGAGCAGTTGTCTGATGANN
HKR344451 RBb61C03 pGCAP1 NM_006136.2  
TGGTTTTGTCGCCAGAAGGAAGATGGCGGATCTGGAGGAGCAGTTGTCTGATGAAGAGAA
HKR433237 RBdS083B13 pGCAP10 NM_006136.2  
GGGGGTGCGCGTGCGCGGCGGCCTGAGCGGCGGGCCCCTCCCTTAGCGGGGGCGCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl