Prev. |  KEGG KO K08583 > 

RIKEN DNA Bank Human Resource - CAPNS1

Gene ID NCBI Gene 826 |  KEGG hsa:826
Gene Symbol CAPNS1
Protein Name calpain small subunit 1
Synonyms CALPAIN4|CANP|CANPS|CAPN4|CDPS|CSS1
Ortholog resources KEGG ortholog (KEGG orthology K08583) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB08253 pcDNA3.1-Flag-human-CAPNS1(30K) Expression vector of human calpain, small subunit 1, FLAG-tagged

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX055968 IRAK139P08 pCMV-SPORT6 BC064998 NM_001749 Full/var
HGY082020 IRAL005A20 pOTB7 BC000592 NM_001749 Full
HGY087132 IRAL017N20 pOTB7 BC007779 NM_001749 Full
HGY088355 IRAL020O19 pOTB7 BC018931 NM_001749 Full
HGY091410 IRAL028I18 pOTB7 BC011903 NM_001749 Partial
HGY095899 IRAL039M11 pOTB7 BC023643 NM_001749 Full
HGY095952 IRAL039O16 pOTB7 BC017308 NM_001749 Full
HGY096271 IRAL040L07 pOTB7 BC021933 NM_001749 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053324 ARe33F04 pKA1U5 NM_001749.2  
GAGTGGAACCGACTCCCAGAACTCCGGACGTGTNCGTCGATGAGTCGCAGCCATGTTCCT
HKR071275 ARe78D03 pKA1U5 NM_001749.2  
GGGACGCTGCGGGAGGCCCGGGAGCGGCAGTGGAACCGACTCCCAGAACTCCGGACGTGT
HKR071752 ARe79G08 pKA1U5 NM_001749.2  
GGCCGGAAATGCGTGTTTGAAGGGAGGGTGTGGGCTCAGGGGCGAAGCACCCACTGGTCC
HKR168505 ARi21E09 pGCAP10 NM_001749.2  
GGCTGCGGGAGGCCCGGGAGCGGCAGTGGAACCGACTCCCAGAACTCCGGACGTGTGCGG
HKR172058 ARi30C10 pGCAP10 NM_001749.2  
GACGCTGCGGGAGGCCCGGGAGCGGCAGTGGACCGACTCCCAGAACTCCGGACGTGTGCG
HKR183299 ARi58E03 pGCAP10 NM_001749.2  
GAGTGGAACCGACTCCCAGAACTCCGGACGTGTGCGGCGCAGTGAGTCGCAGCCATGTTC
HKR203290 ARiS008D18 pGCAP10 NM_001749.2  
GGCCTGAGTCACCGGCCCCGCCCTCCGGAGCCGGACGCTGCGGGAGGCCCGGGAGCGGCA
HKR218011 ARiS045A11 pGCAP10 NM_001749.2  
GGGAACCGACTCCCAGAACTCCGGACGTGTGCGGCGCAGTGAGTCGCAGCCATGTTCCTG
HKR373654 RBd34C06 pGCAP10 NM_001749.2  
CCGGGAGCGGCAGTGGAACCGACTCCCAGAACTCCGGACGTGTGCGGCGCAGTGAGTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl