DNA Bank Top |  KEGG KO K08583 > 

RIKEN DNA Bank Human Resource - CAPNS1

Gene ID NCBI Gene 826 |  KEGG hsa:826
Gene Symbol CAPNS1
Protein Name calpain small subunit 1
Synonyms CALPAIN4|CANP|CANPS|CAPN4|CDPS|CSS1

Link

Ortholog resource in our bank

  CAPNS1


External database

human CAPNS1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB08253 pcDNA3.1-Flag-human-CAPNS1(30K) Expression vector of human calpain, small subunit 1, FLAG-tagged    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055968 IRAK139P08 pCMV-SPORT6 BC064998 NM_001749 Full/var
HGY082020 IRAL005A20 pOTB7 BC000592 NM_001749 Full
HGY087132 IRAL017N20 pOTB7 BC007779 NM_001749 Full
HGY088355 IRAL020O19 pOTB7 BC018931 NM_001749 Full
HGY095899 IRAL039M11 pOTB7 BC023643 NM_001749 Full
HGY095952 IRAL039O16 pOTB7 BC017308 NM_001749 Full
HGY096271 IRAL040L07 pOTB7 BC021933 NM_001749 Full/var
HGY091410 IRAL028I18 pOTB7 BC011903 NM_001749 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053324 ARe33F04 pKA1U5 NM_001749.2  
GAGTGGAACCGACTCCCAGAACTCCGGACGTGTNCGTCGATGAGTCGCAGCCATGTTCCT
HKR071275 ARe78D03 pKA1U5 NM_001749.2  
GGGACGCTGCGGGAGGCCCGGGAGCGGCAGTGGAACCGACTCCCAGAACTCCGGACGTGT
HKR071752 ARe79G08 pKA1U5 NM_001749.2  
GGCCGGAAATGCGTGTTTGAAGGGAGGGTGTGGGCTCAGGGGCGAAGCACCCACTGGTCC
HKR168505 ARi21E09 pGCAP10 NM_001749.2  
GGCTGCGGGAGGCCCGGGAGCGGCAGTGGAACCGACTCCCAGAACTCCGGACGTGTGCGG
HKR172058 ARi30C10 pGCAP10 NM_001749.2  
GACGCTGCGGGAGGCCCGGGAGCGGCAGTGGACCGACTCCCAGAACTCCGGACGTGTGCG
HKR183299 ARi58E03 pGCAP10 NM_001749.2  
GAGTGGAACCGACTCCCAGAACTCCGGACGTGTGCGGCGCAGTGAGTCGCAGCCATGTTC
HKR203290 ARiS008D18 pGCAP10 NM_001749.2  
GGCCTGAGTCACCGGCCCCGCCCTCCGGAGCCGGACGCTGCGGGAGGCCCGGGAGCGGCA
HKR218011 ARiS045A11 pGCAP10 NM_001749.2  
GGGAACCGACTCCCAGAACTCCGGACGTGTGCGGCGCAGTGAGTCGCAGCCATGTTCCTG
HKR373654 RBd34C06 pGCAP10 NM_001749.2  
CCGGGAGCGGCAGTGGAACCGACTCCCAGAACTCCGGACGTGTGCGGCGCAGTGAGTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl