DNA Bank Top |  KEGG KO K01367 > 

RIKEN DNA Bank Human Resource - CAPN1

Gene ID NCBI Gene 823 |  KEGG hsa:823
Gene Symbol CAPN1
Protein Name calpain 1
Synonyms CANP|CANP1|CANPL1|SPG76|muCANP|muCL
Featured content Apoptosis - human
Featured content Alzheimer disease - human

Link

Ortholog resource in our bank

  CAPN1


External database

human CAPN1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB02738 AxCAhmuCalpain (forward) Recombinant adenovirus harboring human mu calpain cDNA    
RDB02284 pAxCAhmuCalpain (reverse) Shuttle vector to produce rAd expressing human mu-calpain    
RDB02283 pAxCAhmuCalpain (forward) Shuttle vector to produce rAd expressing human mu-calpain    
RDB01652 pHM31 Human mu-calpain large subunit cDNA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066682 IRAK166L18 pCMV-SPORT6 BC075862 NM_005186 Full/var
HGY084814 IRAL012A14 pOTB7 BC017200 NM_005186 Full
HGY082264 IRAL005K24 pOTB7 BC008751 NM_005186 Full/var
HGY090357 IRAL025O21 pOTB7 BC015091 NM_005186 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR395300 RBd88E04 pGCAP10 NM_005186.2  
GCCCTCCTCAGAGCAGCTGCCGCAGCCCGAGGATGTCGGAGGAGATCATCACGCCGGTGT
HKR444196 RBdS110I04 pGCAP10 NM_005186.2  
GCNNNNCGCTGCCAGCCCGGCCCCTCCTCAGAGCAGCTGCCGCAGCCCGAGGATGTCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl