Prev. |  KEGG KO K01367 > 

RIKEN DNA Bank Human Resource - CAPN1

Gene ID NCBI Gene 823 |  KEGG hsa:823
Gene Symbol CAPN1
Protein Name calpain 1
Synonyms CANP|CANP1|CANPL1|SPG76|muCANP|muCL
Ortholog resources KEGG ortholog (KEGG orthology K01367) in the DNA Bank
Featured content Apoptosis - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01652 pHM31 Human mu-calpain large subunit cDNA
RDB02283 pAxCAhmuCalpain (forward) Shuttle vector to produce rAd expressing human mu-calpain
RDB02284 pAxCAhmuCalpain (reverse) Shuttle vector to produce rAd expressing human mu-calpain
RDB02738 AxCAhmuCalpain (forward) Recombinant adenovirus harboring human mu calpain cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066682 IRAK166L18 pCMV-SPORT6 BC075862 NM_005186 Full/var
HGY082264 IRAL005K24 pOTB7 BC008751 NM_005186 Full/var
HGY084814 IRAL012A14 pOTB7 BC017200 NM_005186 Full
HGY090357 IRAL025O21 pOTB7 BC015091 NM_005186 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR395300 RBd88E04 pGCAP10 NM_005186.2  
GCCCTCCTCAGAGCAGCTGCCGCAGCCCGAGGATGTCGGAGGAGATCATCACGCCGGTGT
HKR444196 RBdS110I04 pGCAP10 NM_005186.2  
GCNNNNCGCTGCCAGCCCGGCCCCTCCTCAGAGCAGCTGCCGCAGCCCGAGGATGTCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl