Prev. |  KEGG KO K08054 > 

RIKEN DNA Bank Human Resource - CANX

Gene ID NCBI Gene 821 |  KEGG hsa:821
Gene Symbol CANX
Protein Name calnexin
Synonyms CNX|IP90|P90
Featured content Lectin - human
Ortholog resource in our bank

  CANX

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010660 IRAK026K20 pCMV-SPORT6 BC042843 NM_001746 Full
HGY083476 IRAL008L12 pOTB7 BC003552 NM_001746 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052897 ARe32E01 pKA1U5 NM_001746.3  
GCTCTTGGTTCTGCGGCACGTGACGGTCGGGCCGCCTCCGCCTCTCTCTTTACTGCGGCG
HKR235502 ARiS088M14 pGCAP10 NM_001746.3  
GAGGGCTTCGTGCGGTGGGGCTCGCTCGCGCGGCAGCGGTGGCCGAGGCCTCTTGGTTCT
HKR260069 ARiS150C21 pGCAP10 NM_001746.3  
HKR276628 ARiS191J12 pGCAP10 NM_001746.3  
GAGGGCTTCGTGCGGTGGGGCTCGCTCGCGCGGCAGCGGTGGCCGAGGCCTCTTGGTTCT
HKR279420 ARiS198J04 pGCAP10 NM_001746.3  
GGAGTACTGGGTATGTGTCACATTGCCAAATCCCGGATCACAAGTCTCCATGAACTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl