Prev. |  KEGG KO K04515 > 

RIKEN DNA Bank Human Resource - CAMK2G

Gene ID NCBI Gene 818 |  KEGG hsa:818
Gene Symbol CAMK2G
Protein Name calcium/calmodulin dependent protein kinase II gamma
Synonyms CAMK|CAMK-II|CAMKG|MRD59
Featured content Wnt signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Axon guidance - human
Ortholog resource in our bank

  CAMK2G

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013051 IRAK032K11 pBluescriptR BC034044 NM_172169 Full/var
HGY030331 IRAK075N19 pBluescriptR BC037928 NM_172173
HGY090368 IRAL025P08 pOTB7 BC012795 NM_172173 Partial/var
HGY095717 IRAL039E21 pOTB7 BC021269 NM_172170 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042805 ARe07A05 pKA1U5 NM_172171.1  
GTCTCCTCCTCTTGCTCCCTCGGCCGGGCGGCGGTGACTGTGCACCGACGTCGGCGCGGG
HKR362904 RBd07E08 pGCAP10 NM_172171.1  
GGTCTCCTCCTCTTGCTCCCTCGGCCGGGCGGCGGTGACTGTGCACCGACGTCGGCGCGG
HKR392875 RBd82D03 pGCAP10 NM_172171.1  
GGACTGTGCACCGACGTCGGCGCGGGCTGCACCGCCGCGTCCGCCCGCCCGCCAGCATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl