Prev. | 

RIKEN DNA Bank Human Resource - CALU

Gene ID NCBI Gene 813 |  KEGG hsa:813
Gene Symbol CALU
Protein Name calumenin
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082824 IRAL007A24 pOTB7 BC013383 NM_001219 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005953 W01A014O17 pENTR-TOPO IRAL007A24 BC013383 NM_001219  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054008 ARe35A08 pKA1U5 NM_001219.3  
GGGGCGGTGCTTGCGCGCGTGAGCTGAGCCGGCNGGGTGAGCGGCGGCCACGGCATCCTG
HKR068802 ARe72A02 pKA1U5 NM_001219.3  
GTGGGCGGTGCTTGCGCGCGTGAGCTGAGCCGGTGGGTGAGCGGCGGCCACGGCATCCTG
HKR177631 ARi44B07 pGCAP10 NM_001219.3  
GGCGCGCGTGAGCTGAGCCGGTGGGTGAGCGGCGGCCACGGCATCCTGTGCTGTGGGGGC
HKR247437 ARiS118J21 pGCAP10 NM_001219.3  
GCTGTGCTGTGGGGGCTACNAGGAAAGATCTAATTATCATGGACCTGCGACAGTTTCTTA
HKR420557 RBdS051G13 pGCAP10 NM_001219.3  
GGCTTGCGCGCGTGAGCTGAGCCGGTGGGTGAGCGGCGGCCACGGCATCCTGTGCTGTGG
HKR470969 RBdS177H01 pGCAP10 NM_001219.3  
GGCTTGCGCGCGTGAGCTGAGCCGGTGGGTGAGCGGCGGCCACGGCATCCTGTGCTGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl