Prev. |  KEGG KO K04858 > 

RIKEN DNA Bank Human Resource - CACNA2D1

Gene ID NCBI Gene 781 |  KEGG hsa:781
Gene Symbol CACNA2D1
Protein Name calcium voltage-gated channel auxiliary subunit alpha2delta 1
Synonyms CACNA2|CACNL2A|CCHL2A|LINC01112|lncRNA-N3
Ortholog resource in our bank

  CACNA2D1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099054 IRAL047K14 pOTB7 BC051339 NM_000722 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208115 ARiS020E19 pGCAP10 NM_000722.2  
GGCGAGAGCGCGCGAGCGCCGGCGGGCTCGCCGAGGTCTGTTTCCAAAGTCGCCCTTGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl