Prev. |  KEGG KO K05124 > 

RIKEN DNA Bank Human Resource - DDR1

Gene ID NCBI Gene 780 |  KEGG hsa:780
Gene Symbol DDR1
Protein Name discoidin domain receptor tyrosine kinase 1
Synonyms CAK|CD167|DDR|EDDR1|HGK2|MCK10|NEP|NTRK4|PTK3|PTK3A|RTK6|TRKE
Ortholog resource in our bank

  DDR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067027 IRAK167J11 pBluescriptR BC070070 NM_001954 Full/var
HGY080760 IRAL001O24 pOTB7 BC008716 NM_001954 Full
HGY084141 IRAL010F21 pOTB7 BC013400 NM_001954 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR191251 ARi78C03 pGCAP10 NM_001954.4  
CGGCCGGCCGATTGGCGGCGCCTGGGCCCGAGCCGCCCCAGCCCTGGCTCCTCTCCCCGG
HKR444381 RBdS110P21 pGCAP10 NM_001954.4  
GACCCGAGCCCCGCCGGCGCCTCCCGCTCCCGGCTCCCGGCTCCTGGCTCCCTCCGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl