Prev. |  KEGG KO K17430 > 

RIKEN DNA Bank Human Resource - MRPL49

Gene ID NCBI Gene 740 |  KEGG hsa:740
Gene Symbol MRPL49
Protein Name mitochondrial ribosomal protein L49
Synonyms C11orf4|L49mt|MRP-L49|NOF|NOF1
Ortholog resource in our bank

  MRPL49

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085236 IRAL013B12 pOTB7 BC004378 NM_004927 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066054 ARe65C06 pKA1U5 NM_004927.2  
GACAGAAGGCTGGCGTAGCAGGTAAAGATGGCAGCTACCATGNTTCCGGGCTACGCTGCG
HKR077606 ARe94A06 pKA1U5 NM_004927.2  
GGGCGTAGCAGGTAAAGATGGCAGCTACCATGTTCCGGGCTACGCTGCGGGGATGGAGAA
HKR187708 ARi69E12 pGCAP10 NM_004927.2  
GGCACAGAAGGCTGGCGTAGCAGGTAAAGATGGCAGCTACCATGTTCCGGGCTACGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl