Prev. |  KEGG KO K08574 > 

RIKEN DNA Bank Human Resource - CAPN5

Gene ID NCBI Gene 726 |  KEGG hsa:726
Gene Symbol CAPN5
Protein Name calpain 5
Synonyms ADNIV|HTRA3|VRNI|nCL-3
Ortholog resource in our bank

  CAPN5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03495 pAxCALNLhCAPN5 (forward) Shuttle vector to generate rAd harboring human CAPN5 (forward)
RDB04079 pAxCALNLhCAPN5 (reverse) Shuttle vector to generate rAd harboring human CAPN5 (reverse)
RDB05000 pAxCALNLhCAPN5(forward) Shuttle vector to generate rAd expressing human CAPN5
RDB05001 pAxCALNLhCAPN5(reverse) Shuttle vector to generate rAd expressing human CAPN5

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008997 IRAK022I05 pCMV-SPORT6 BC018123 NM_004055 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066001 ARe65A01 pKA1U5 NM_004055.4  
GAGTCCCAGCTGGATCTCCGGCCAGAGCCCGAGGCTGCTGCGCCGGGCGGCTGCAGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl