Prev. |  KEGG KO K05770 > 

RIKEN DNA Bank Human Resource - TSPO

Gene ID NCBI Gene 706 |  KEGG hsa:706
Gene Symbol TSPO
Protein Name translocator protein
Synonyms BPBS|BZRP|DBI|IBP|MBR|PBR|PBS|PKBS|PTBR|mDRC|pk18
Ortholog resource in our bank

  TSPO

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081540 IRAL003O04 pOTB7 BC001110 NM_007311 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004331 W01A010N19 pENTR-TOPO IRAL003O04 BC001110 NM_007311  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050829 ARe27B05 pKA1U5 NM_000714.4  
TGGAGCGTGCCCTCGCCGCTGAGCTCCCCTGAACAGCAGCTGCAGCAGCCATGGCCCCGC
HKR053636 ARe34B12 pKA1U5 NM_000714.4  
GGGAGCGTGCCCTCGCCGCTGGTACGGCTCCTACCTGGTCTGGAAAGAGCTGGGAGGCTT
HKR064979 ARe62H11 pKA1U5 NM_000714.4  
GAGTGCCCTTCCCGGAGCGTGCCCTCGCCGCTGAGCTCCCCTGAACAGCAGCTGCAGCAG
HKR069378 ARe73H10 pKA1U5 NM_000714.4  
GCCCGGAGCGTGCCCTCGCCGCTGAGCTCCCCNCAATTAACAGCTGCAGCAGCCATGGCC
HKR161674 ARi04D02 pGCAP10 NM_000714.4  
GGGGGACAGCGGCCTGGCTAACTCCTGCCAGGCAGTGCCCTTCCCGGAGCGTGCCCTCGC
HKR163345 ARi08G01 pGCAP10 NM_000714.4  
GGGAGCGTGCCCTCGCCGCTGAGCTCCCCTGAACAGCAGCTGCAGCAGCCATGGCCCCGC
HKR164925 ARi12F05 pGCAP10 NM_000714.4  
GGCGGGGACAGCGGCCTGGCTAACTCCTGCCAGGCAGTGCCCTTCCCGGAGCGTGCCCTC
HKR171631 ARi29B07 pGCAP10 NM_000714.4  
GGGCCTGGCTAACTCCTGCCAGAGTGAGTGCCCGGCCCACCAGGGACTGCAGCTGCACCA
HKR179260 ARi48C12 pGCAP10 NM_000714.4  
GAGTGCCCTTCCCGGAGCGTGCCCTCGCCGCTGAGCTCCCCTGAACAGCAGCTGCAGCAG
HKR219868 ARiS049L04 pGCAP10 NM_000714.4  
GAGTGCCCTTCCCGGAGCGTGCCCTCNCCGCTGAGCTCCCCTGAACAGCAGCTGCAGCAG
HKR219943 ARiS049O07 pGCAP10 NM_000714.4  
TGGGCCAGGCAGTGCCCTTCCCGGAGCGTGCCCTCNCCGCTGANCTCCCCTGAACAGCAG
HKR260013 ARiS150A13 pGCAP10 NM_000714.4  
GGCGGATGCGGGGACAGCGGCCTGGCTAACTCCTGCCAGGCAGTGCCCTTCCCGGAGCGT
HKR260036 ARiS150B12 pGCAP10 NM_000714.4  
GAGTGCCCTTCCCGGAGCGTGCCCTCGCCGCTGAGCTCCCCTGAACAGCAGCTGCAGCAG
HKR264708 ARiS161M20 pGCAP10 NM_000714.4  
GGGGGCGGATGCGGGGACAGCGGCCTGGCTAACTCCTGCCAGGCAGTGCCCTTCCCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl