Prev. |  KEGG KO K06637 > 

RIKEN DNA Bank Human Resource - BUB1B

Gene ID NCBI Gene 701 |  KEGG hsa:701
Gene Symbol BUB1B
Protein Name BUB1 mitotic checkpoint serine/threonine kinase B
Synonyms BUB1beta|BUBR1|Bub1A|MAD3L|MVA1|SSK1|hBUBR1
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  BUB1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096166 IRAL040G22 pOTB7 BC018739 NM_001211 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059380 ARe48H12 pKA1U5 NM_001211.5  
GAGGGAGTCGTGTACGTGCCTTGGTCGCTTCTGTAGCTCCGAGGGCAGGTTGCGGAAGAA
HKR070145 ARe75G01 pKA1U5 NM_001211.5  
AGGGAGTCGTGTACGTGCCTTGGTCGCTTCTNCCTTTCCGAGGGCAGGTTGCGGAAGAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl