Prev. |  KEGG KO K14443 > 

RIKEN DNA Bank Human Resource - BTG1

Gene ID NCBI Gene 694 |  KEGG hsa:694
Gene Symbol BTG1
Protein Name BTG anti-proliferation factor 1
Synonyms APRO2
Ortholog resources KEGG ortholog (KEGG orthology K14443) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001278 IRAK003D06 pCMV-SPORT6 BC009050 NM_001731 Partial/var
HGX056104 IRAK140E08 pCMV-SPORT6 BC064953 NM_001731 Full
HGY081233 IRAL003B09 pOTB7 BC016759 NM_001731 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000425 W01A001B01 pENTR-TOPO IRAL003B09 BC016759 NM_001731  
HGE000427 W01A001B03 pENTR-TOPO IRAL003B09 BC016759 NM_001731  
HGE000429 W01A001B05 pENTR-TOPO IRAL003B09 BC016759 NM_001731  
HGE000431 W01A001B07 pENTR-TOPO IRAL003B09 BC016759 NM_001731  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047376 ARe18H08 pKA1U5 NM_001731.1  
TGTTCGCCTCTCGGAGCTGGAAATGCAGCTATTGAGATCTTCGAATGCTGCGGAGCTGGA
HKR068947 ARe72G03 pKA1U5 NM_001731.1  
GTCGCCTCTCGGAGCTGGAAATGCAGCTATTGAGATCTTCGAATGCTGCGGAGCTGGAGG
HKR168809 ARi22A09 pGCAP10 NM_001731.1  
GTTCGCCTCTCGGAGCTGGAAATGCAGCTATTGAGATCTTCGAATGCTGCGGAGCTGGAG
HKR218088 ARiS045D16 pGCAP10 NM_001731.1  
GCTTCGCCTCTCGGAGCTGGAAATGCAGCTATTGAGATCTTCGAATGCTGCGGAGCTGGA
HKR248828 ARiS122B04 pGCAP10 NM_001731.1  
GTTCGCCTCTCGGAGCTGGAAATGCAGCTATTGAGATCTTCGAATGCTGCGGAGCTGGAG
HKR332829 RBb32B05 pGCAP1 NM_001731.1  
ATCTCTTCGCCTCTCGGAGCTGGAAATGCAGCTATTGAGGTCTTCGAATGCTGCGGAGCT
HKR405219 RBdS013A19 pGCAP10 NM_001731.1  
GTTCGCCTCTCGGAGCTGGAAATGCAGCTATTGAGGTCTTCGAATGCTGCGGAGCTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl