Prev. |  KEGG KO K15464 > 

RIKEN DNA Bank Human Resource - BNIP3

Gene ID NCBI Gene 664 |  KEGG hsa:664
Gene Symbol BNIP3
Protein Name BCL2 interacting protein 3
Synonyms NIP3
Ortholog resources KEGG ortholog (KEGG orthology K15464) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067333 IRAK168F13 pBluescriptR BC067818 NM_004052 Full
HGY090614 IRAL026I22 pOTB7 BC009342 NM_004052 Full
HGY093172 IRAL032P12 pDNR-LIB BC021989 NM_004052 Full
HGY103693 IRAL059D21 pOTB7 BC080643 NM_004052 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019519 W01A048N07 pENTR-TOPO IRAL032P12 BC021989 NM_004052  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042852 ARe07C04 pKA1U5 NM_004052.2  
GAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCGCAGC
HKR047276 ARe18D04 pKA1U5 NM_004052.2  
GAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCGCAGC
HKR050907 ARe27E11 pKA1U5 NM_004052.2  
GGCTCAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCG
HKR052177 ARe30H09 pKA1U5 NM_004052.2  
GAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCGCAGC
HKR064921 ARe62F01 pKA1U5 NM_004052.2  
GGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCGCAGCT
HKR073721 ARe84F01 pKA1U5 NM_004052.2  
GAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCGCAGC
HKR074155 ARe85G11 pKA1U5 NM_004052.2  
GGCCCTGTGAGTTCCTCCGGCCGGGCTGCGGGGCTCCGCTCAGTCCGGGAGCGCAGCTGG
HKR079704 ARe99E08 pKA1U5 NM_004052.2  
GGCTCAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCG
HKR165351 ARi13G07 pGCAP10 NM_004052.2  
TGGCCCTCTGGCGCCATGTCGCAGAACGGAGCGCCCGGGATGCAGGAGGAGAGCCTGCAG
HKR175212 ARi38A12 pGCAP10 NM_004052.2  
GGCGGGGCTCCGCTCAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTC
HKR178082 ARi45D10 pGCAP10 NM_004052.2  
TGCAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCGCA
HKR279520 ARiS198N08 pGCAP10 NM_004052.2  
GGGGCTGCGGGGCTCCGCTCAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCG
HKR346899 RBb67E03 pGCAP1 NM_004052.2  
GCCGGCCCCGCCCTGCCCTGTGAGTTCCTCCGGCCGGGCTGCGGGGCTCCGCTCAGTCCG
HKR378433 RBd46B09 pGCAP10 NM_004052.2  
GAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCGCCGCTTTCCCACCGCCCGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl